Stem-loop sequence cin-mir-200

AccessionMI0007175 (change log)
DescriptionCiona intestinalis miR-200 stem-loop
Gene family MIPF0000491; mir-200
Stem-loop
   uu    -   a  g        --    c       cg  g     
5'   cgug cca cc aaucacca  acca guaguau  ga cauu 
     |||| ||| || ||||||||  |||| |||||||  || ||| g
3'   gcau ggu gg uuaguggu  uggu cgucaua  cu gugu 
   au    a   -  g        aa    c       au  -     
Get sequence
Deep sequencing
4573 reads, 1.25e+03 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
scaffold_71: 128174-128259 [+]
intergenic
Clustered miRNAs
< 10kb from cin-mir-200
cin-mir-200scaffold_71: 128174-128259 [+]
cin-mir-3575scaffold_71: 128186-128245 [-]
cin-mir-141scaffold_71: 128547-128621 [+]
cin-mir-5611scaffold_71: 128684-128755 [+]
Database links

Mature sequence cin-miR-200-5p

Accession MIMAT0015263
Previous IDscin-miR-200*
Sequence

16 - 

ucaccaaccacguaguaucg

 - 35

Get sequence
Deep sequencing195 reads, 2 experiments
Evidence experimental; Illumina [3]

Mature sequence cin-miR-200-3p

Accession MIMAT0006110
Previous IDscin-miR-200
Sequence

50 - 

uaauacugccugguaaugguga

 - 71

Get sequence
Deep sequencing4378 reads, 2 experiments
Evidence experimental; Northern [1], Illumina [3]

References

1
PMID:18047675 "Computational prediction and experimental validation of Ciona intestinalis microRNA genes" Norden-Krichmar TM, Holtz J, Pasquinelli AE, Gaasterland T BMC Genomics. 8:445(2007).
2
PMID:18339653 "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" Fu X, Adamski M, Thompson EM Mol Biol Evol. 25:1067-1080(2008).
3