Stem-loop sequence csa-let-7a

AccessionMI0007181 (change log)
DescriptionCiona savignyi let-7a stem-loop
Gene family MIPF0000002; let-7
Literature search

2 open access papers mention csa-let-7a
(14 sentences)

Stem-loop
   --------ca      cucaaaau   g    a       u      aauauu    c 
5'           aagccg        gag uagu gguuaua caguug      uuac a
             ||||||        ||| |||| ||||||| ||||||      ||||  
3'           uuuggc        uuc auca ccaauau gucaau      agug u
   acgacuauca      -aaauucu   g    a       -      ------    g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CSAV2.0) Overlapping transcripts
reftig_41: 1116068-1116169 [+]
intergenic
Clustered miRNAs
< 10kb from csa-let-7a
csa-let-7c-1reftig_41: 1114139-1114239 [+]
csa-let-7breftig_41: 1115604-1115705 [+]
csa-let-7areftig_41: 1116068-1116169 [+]
csa-let-7c-2reftig_41: 1117496-1117597 [+]
Database links

Mature sequence csa-let-7a

Accession MIMAT0006116
Sequence

16 - 

ugagguaguagguuauaucagu

 - 37

Get sequence
Evidence by similarity; MI0001259

References

1
PMID:18339653 "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" Fu X, Adamski M, Thompson EM Mol Biol Evol. 25:1067-1080(2008).