Stem-loop sequence csa-let-7c-1

AccessionMI0007183 (change log)
DescriptionCiona savignyi let-7c-1 stem-loop
Gene family MIPF0000002; let-7
Literature search

2 open access papers mention csa-let-7c-1
(14 sentences)

Stem-loop
   gggcu   c     au       u            uuuu  -    aa     u 
5'      ucu ccaca  gagguag agguuaugcagu    gc cuug  uguuu u
        ||| |||||  ||||||| ||||||||||||    || ||||  |||||  
3'      aga ggugu  uuccguc uccaauguguca    cg ggac  acgga a
   ---gu   c     --       u            ---u  a    --     g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CSAV2.0) Overlapping transcripts
reftig_41: 1114139-1114239 [+]
intergenic
Clustered miRNAs
< 10kb from csa-let-7c-1
csa-let-7c-1reftig_41: 1114139-1114239 [+]
csa-let-7breftig_41: 1115604-1115705 [+]
csa-let-7areftig_41: 1116068-1116169 [+]
csa-let-7c-2reftig_41: 1117496-1117597 [+]
Database links

Mature sequence csa-let-7c

Accession MIMAT0006118
Sequence

16 - 

ugagguaguagguuaugcaguu

 - 37

Get sequence
Evidence by similarity; MI0007138

References

1
PMID:18339653 "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" Fu X, Adamski M, Thompson EM Mol Biol Evol. 25:1067-1080(2008).