Stem-loop sequence csa-let-7d

AccessionMI0007185 (change log)
DescriptionCiona savignyi let-7d stem-loop
Gene family MIPF0000002; let-7
Literature search

2 open access papers mention csa-let-7d
(14 sentences)

Stem-loop
   -------------ga   uau      a      -            u   uua a    
5'                ggc   ucacag ugaggu aguugguuguau guu   c ccu 
                  |||   |||||| |||||| |||||||||||| |||   | || u
3'                ucg   gguguc auuuca ucgaccgacaua caa   g ggc 
   acgaccugcuauaaa   -uu      -      a            u   -ua c    
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CSAV2.0) Overlapping transcripts
reftig_44: 256943-257044 [+]
intergenic
Clustered miRNAs
< 10kb from csa-let-7d
csa-mir-1473reftig_44: 256366-256466 [+]
csa-let-7dreftig_44: 256943-257044 [+]
Database links

Mature sequence csa-let-7d

Accession MIMAT0006119
Sequence

16 - 

ugagguaguugguuguauuguu

 - 37

Get sequence
Evidence by similarity; MI0007139

References

1
PMID:18339653 "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" Fu X, Adamski M, Thompson EM Mol Biol Evol. 25:1067-1080(2008).