![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR162a |
|||||
Accession | MI0007208 (change log) | ||||
Previous IDs | gma-MIR162 | ||||
Description | Glycine max miR162a stem-loop | ||||
Gene family | MIPF0000127; MIR162_1 | ||||
Literature search |
![]()
10 open access papers mention gma-MIR162a | ||||
Stem-loop |
-- a u a c c uc c aa -gu u 5' guga g c cuggaugcag gguu aucgauc uuc ug uc ug u |||| | | |||||||||| |||| ||||||| ||| || || || u 3' cacu c g gaccuacguc ccaa uagcuag aag ac ag ac a cu - - c u a cu u ca acu a |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gma-miR162a |
|
Accession | MIMAT0007353 |
Previous IDs | gma-miR162 |
Sequence |
73 - ucgauaaaccucugcaucca - 92 |
Evidence | experimental; 454 [1], Illumina [2] |
References |
|
1 |
PMID:18402695
"Novel and nodulation-regulated microRNAs in soybean roots"
BMC Genomics. 9:160(2008).
|
2 |
PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"
Genes Dev. 25:2540-2553(2011).
|