Stem-loop gma-MIR162a

Accession

MI0007208

Description

Glycine max gma-MIR162a precursor miRNA

Gene family

MIPF0000127; MIR162_1

Literature search

10 open access papers mention gma-MIR162a
(15 sentences)

Sequence

gugaagucacuggaugcagcgguucaucgaucucuuccugaaucguuguuuaacaucagaaccaugaaucgaUCGAUAAACCUCUGCAUCCAgcgcucacuc
((((.(.(.((((((((((.((((.(((((((..(((.((..((..(((...)))...))..)).)))..))))))).)))).)))))))))).))))))..

Structure

--    a u a          c    c       uc   c  aa  -gu   u 
  guga g c cuggaugcag gguu aucgauc  uuc ug  uc   ugu  
  |||| | | |||||||||| |||| |||||||  ||| ||  ||   ||| u
  cacu c g gACCUACGUC CCAA UAGCUag  aag ac  ag   aca  
cu    - - c          U    A       cu   u  ca  acu   a 

Annotation confidence Not enough data

Genome context

chr6: 20376062-20376163 [-]

Mature gma-miR162a

• Accession: MIMAT0007353
• Description: Glycine max gma-miR162a mature miRNA
• Sequence: 73 - UCGAUAAACCUCUGCAUCCA - 92
• Evidence: experimental ; 454 [1], Illumina [2]

References

1. PubMed ID: 18402695
   Novel and nodulation-regulated microRNAs in soybean roots
   Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O
   BMC Genomics (2008) 9:160


2. PubMed ID: 22156213
   MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs
   "Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC"
   "Genes Dev (2011) 25:2540-2553