Stem-loop sequence gma-MIR1512a

AccessionMI0007224 (change log)
Previous IDsgma-MIR1512
DescriptionGlycine max miR1512 stem-loop
Gene family MIPF0001291; MIR1512
Literature search

11 open access papers mention gma-MIR1512a
(25 sentences)

Stem-loop
   -uc     u c         a                 -  a   aaa 
5'    uugau c uaacugaaa uucuuaaaguauuccca uc ucg   u
      ||||| | ||||||||| ||||||||||||||||| || |||    
3'    aacua g auugacuuu aagaauuucguaagggu ag agu   g
   acu     c u         -                 u  a   aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr18: 56521611-56521705 [+]
intergenic
Database links

Mature sequence gma-miR1512a-5p

Accession MIMAT0007370
Previous IDsgma-miR1512a
Sequence

11 - 

uaacugaaaauucuuaaaguau

 - 32

Get sequence
Evidence experimental; 454 [1]

Mature sequence gma-miR1512a-3p

Accession MIMAT0032030
Sequence

66 - 

gcuuuaagaauuucaguuaug

 - 86

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).
2