Stem-loop sequence gma-MIR1520a

AccessionMI0007235 (change log)
DescriptionGlycine max miR1520a stem-loop
Gene family MIPF0000581; MIR1520
Literature search

2 open access papers mention gma-MIR1520a
(2 sentences)

Stem-loop
   aaaggaauguugaccgucaugugucauguucuu                --                   ---     gaaa    -ca   c 
5'                                  auuggaugaugacugu  ugugucauguucugauugg   ucaau    auaa   aug a
                                    ||||||||||||||||  |||||||||||||||||||   |||||    ||||   ||| u
3'                                  uaaccuacuacugaca  acauaguacaagauuaacc   aguug    uauu   uac u
   --------------------------------a                gu                   uac     -agg    uuc   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr14: 17975535-17975684 [-]
intergenic
Database links

Mature sequence gma-miR1520a

Accession MIMAT0007381
Sequence

118 - 

uagaacaugauacaugacaguca

 - 140

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).