Stem-loop sequence gma-MIR1522

AccessionMI0007237 (change log)
DescriptionGlycine max miR1522 stem-loop
Literature search

1 open access papers mention gma-MIR1522
(7 sentences)

Stem-loop
   uacagacaaau     gc       g       - c      cu   aaugcauaaaauaguuaauguuuuauaauuaguaugauuacccgugu 
5'            uuauu  uuaaaau aaauuaa c aacuuu  uaa                                               a
              |||||  ||||||| ||||||| | ||||||  |||                                                
3'            aauaa  aauuuua uuuaauu g uugaga  auu                                               a
   -auaaauaauu     ga       a       u a      au   aauaaaaguuagugaaauaguacuuaaucuuuuuaguguuacaaugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr4: 13894953-13895140 [+]
intergenic
chr4: 13918581-13918768 [+]
intergenic
Database links

Mature sequence gma-miR1522

Accession MIMAT0007383
Sequence

11 - 

uuuauugcuuaaaaugaaau

 - 30

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).