Stem-loop sequence gga-mir-1562

AccessionMI0007287 (change log)
DescriptionGallus gallus miR-1562 stem-loop
Literature search

1 open access papers mention gga-mir-1562
(7 sentences)

Stem-loop
   aucaa    c g   --   g          gaugga     u   u    g g 
5'      caag g ggu  gca cugcacugua      ggggc gca gaag u g
        |||| | |||  ||| ||||||||||      ||||| ||| |||| |  
3'      guuc c uca  cgu gacgugacgu      ccccg ugu cuuu a a
   ---ug    a g   cu   g          -augug     -   -    g u 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr8: 24243083-24243184 [+]
sense
ENSGALT00000017177 ; OSBPL9-201; intron 10
Database links

Mature sequence gga-miR-1562-5p

Accession MIMAT0007420
Previous IDsgga-miR-1562
Sequence

22 - 

gcacuguagauggaggggcugc

 - 43

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-1562-3p

Accession MIMAT0007421
Previous IDsgga-miR-1562*
Sequence

62 - 

ugugccccguguaugcagugca

 - 83

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).