Stem-loop sequence gga-mir-1587

AccessionMI0007314 (change log)
DescriptionGallus gallus miR-1587 stem-loop
Literature search

2 open access papers mention gga-mir-1587
(2 sentences)

Stem-loop
       -cc  -c      c   -cu   cu   c    c     ag    g 
5' ggcg   gc  ggggca ggg   ggg  ggg uggg agcgg  cgcg c
   ||||   ||  |||||| |||   |||  ||| |||| |||||  ||||  
3' ucgc   ug  ucccgu ccu   ucu  ucc gccc ucguc  gcgc a
       caa  cu      -   ucu   uu   u    -     -g    u 
Get sequence
Deep sequencing
132 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr19: 1798669-1798764 [-]
sense
Clustered miRNAs
< 10kb from gga-mir-1587
gga-mir-1587chr19: 1798669-1798764 [-]
gga-mir-1354chr19: 1792020-1792095 [-]
Database links

Mature sequence gga-miR-1587

Accession MIMAT0007449
Sequence

17 - 

gggcugggcugggcugggca

 - 36

Get sequence
Deep sequencing128 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).