Stem-loop sequence gga-mir-1665

AccessionMI0007399 (change log)
DescriptionGallus gallus miR-1665 stem-loop
Literature search

1 open access papers mention gga-mir-1665
(1 sentences)

Stem-loop
        ---            a ga     g    ag gau 
5' gauac   gagguaaggccc g  gcgcu cagc  g   g
   |||||   |||||||||||| |  ||||| ||||  |    
3' uugug   uuucguuccggg c  uguga gucg  c   c
        aac            a uc     g    -a agu 
Get sequence
Deep sequencing
6 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr8: 19809647-19809724 [+]
sense
ENSGALT00000044617 ; SZT2-201; 3'UTR (exon 22)
Database links

Mature sequence gga-miR-1665

Accession MIMAT0007548
Sequence

10 - 

uaaggcccaggagcgcugcagc

 - 31

Get sequence
Deep sequencing5 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).