Stem-loop sequence gga-mir-1668

AccessionMI0007402 (change log)
DescriptionGallus gallus miR-1668 stem-loop
Literature search

3 open access papers mention gga-mir-1668
(10 sentences)

Stem-loop
   --gagg  -u   c  c       c    ag     g   ug  g   
5'       gc  gcc ug agguggg uggg  cacag cac  ug gc 
         ||  ||| || ||||||| ||||  ||||| |||  || | u
3'       cg  cgg ac uccacuc acuc  guguc gug  gu cu 
   cuaaga  uu   u  u       -    cu     -   gu  g   
Get sequence
Deep sequencing
17 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence does not map exactly to the galGal4.0 chicken genome assembly, but is annotated based on a Trace Achive sequence (rul06e06.b1).

Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr33: 217270-217359 [-]
intergenic
Database links

Mature sequence gga-miR-1668-5p

Accession MIMAT0007551
Previous IDsgga-miR-1668*
Sequence

17 - 

gugggcugggagcacaggcacu

 - 38

Get sequence
Deep sequencing5 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-1668-3p

Accession MIMAT0007552
Previous IDsgga-miR-1668
Sequence

54 - 

ugcuguguccucacucaccuu

 - 74

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).