Stem-loop sequence gga-mir-1689

AccessionMI0007423 (change log)
DescriptionGallus gallus miR-1689 stem-loop
Literature search

1 open access papers mention gga-mir-1689
(6 sentences)

Stem-loop
     u uuaugu   gg      a  ---u      a    gu      -g a  a 
5' gg g      cug  cagaag uc    cugcuu cagu  cugggg  g uc u
   || |      |||  |||||| ||    |||||| ||||  ||||||  | ||  
3' cc c      gac  gucuuc ag    gacgaa guca  ggcccc  c gg g
     u ugucuu   gg      -  uugc      g    gu      ga -  c 
Get sequence
Deep sequencing
15 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr19: 9416330-9416433 [-]
sense
ENSGALT00000009362 ; MNT-201; intron 2
Database links

Mature sequence gga-miR-1689-5p

Accession MIMAT0007579
Previous IDsgga-miR-1689*
Sequence

23 - 

ucucugcuuacagugucugggg

 - 44

Get sequence
Deep sequencing12 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-1689-3p

Accession MIMAT0007580
Previous IDsgga-miR-1689
Sequence

61 - 

ccggugacuggaagcagcguuga

 - 83

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).