Stem-loop sequence gga-mir-1764

AccessionMI0007506 (change log)
DescriptionGallus gallus miR-1764 stem-loop
Literature search

2 open access papers mention gga-mir-1764
(6 sentences)

Stem-loop
        c   ---    u       gg     g       a      uga    c 
5' accug uug   gcgu ccauggu  cucag cagcagg ggcuug   gaug u
   ||||| |||   |||| |||||||  ||||| ||||||| ||||||   ||||  
3' uggau aac   ugua ggugucg  ggguc guuguuc ucgaac   uugc g
        c   agg    -       ag     g       g      ---    g 
Get sequence
Deep sequencing
24 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr15: 5824267-5824369 [+]
intergenic
Database links

Mature sequence gga-miR-1764-5p

Accession MIMAT0007671
Previous IDsgga-miR-1764*
Sequence

23 - 

gcucaggcagcaggaggcuug

 - 43

Get sequence
Deep sequencing7 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-1764-3p

Accession MIMAT0007672
Previous IDsgga-miR-1764
Sequence

61 - 

agcugcuuguuggcuggggag

 - 81

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).