![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gga-mir-10a |
|||||
Accession | MI0007559 (change log) | ||||
Description | Gallus gallus miR-10a stem-loop | ||||
Gene family | MIPF0000033; mir-10 | ||||
Literature search |
![]()
19 open access papers mention gga-mir-10a | ||||
Stem-loop |
a g c uaaagg 5' cuauaugu cccu uagau cgaauuugug a |||||||| |||| ||||| |||||||||| a 3' gauguaua gggg aucua gcuuaaacac g a - u uggguu |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gga-miR-10a-5p |
|
Accession | MIMAT0007731 |
Previous IDs | gga-miR-10a |
Sequence |
8 - uacccuguagauccgaauuugu - 29 |
Deep sequencing | 2459657 reads, 5 experiments |
Evidence | experimental; Illumina [1], cloned [2] |
Database links |
|
Predicted targets |
|
Mature sequence gga-miR-10a-3p |
|
Accession | MIMAT0007732 |
Previous IDs | gga-miR-10a* |
Sequence |
49 - aaauucguaucuaggggaaua - 69 |
Deep sequencing | 3840 reads, 4 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:18469162
"A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach"
Genome Res. 18:957-964(2008).
|
2 |
PMID:18511220
"Identification of novel chicken microRNAs and analysis of their genomic organization"
Gene. 418:34-40(2008).
|