Stem-loop sequence gga-mir-10a

Accession

MI0007559 (change log)

Description

Gallus gallus miR-10a stem-loop

Gene family

MIPF0000033; mir-10

Literature search

19 open access papers mention gga-mir-10a
(44 sentences)

Stem-loop

           a    g     c          uaaagg 
5' cuauaugu cccu uagau cgaauuugug      a
   |||||||| |||| ||||| ||||||||||      a
3' gauguaua gggg aucua gcuuaaacac      g
           a    -     u          uggguu 

Deep sequencing

2463497 reads, 3.28e+04 reads per million, 5 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Gallus_gallus-5.0; GCA_000002315.3): chr27: 3834170-3834243 [+]
• Overlapping transcripts:

  intergenic

Database links

• EntrezGene:MIR10A
• RNAcentral:URS0000759D10_9031
• miRBase Tracker:MI0007559

Mature sequence gga-miR-10a-5p

• Accession: MIMAT0007731
• Previous IDs: gga-miR-10a
• Sequence: 8 - uacccuguagauccgaauuugu - 29
• Deep sequencing: 2459657 reads, 5 experiments
• Evidence: experimental; Illumina [1], cloned [2]
• Database links:
  • RNAcentral:URS000055DE1B_9031
• Predicted targets:
  • TargetScanVert:gga-miR-10a-5p
  • miRDB:gga-miR-10a-5p

Mature sequence gga-miR-10a-3p

• Accession: MIMAT0007732
• Previous IDs: gga-miR-10a*
• Sequence: 49 - aaauucguaucuaggggaaua - 69
• Deep sequencing: 3840 reads, 4 experiments
• Evidence: experimental; Illumina [1]
• Database links:
  • RNAcentral:URS000075CFF5_9031
• Predicted targets:
  • TargetScanVert:gga-miR-10a-3p
  • miRDB:gga-miR-10a-3p

References

1. PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).
2. PMID:18511220 "Identification of novel chicken microRNAs and analysis of their genomic organization" Shao P, Zhou H, Xiao ZD, He JH, Huang MB, Chen YQ, Qu LH Gene. 418:34-40(2008).