Stem-loop sequence gga-mir-16c

Accession MI0007563
Description Gallus gallus miR-16c stem-loop
Gene family MIPF0000006; mir-15
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-16_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-16 microRNA precursor family is a group of related small non-coding RNA genes that regulates gene expression. miR-16, miR-15, mir-195 and miR-457 are related microRNA precursor sequences from the mir-15 gene family. This microRNA family appears to be vertebrate specific and its members have been predicted or experimentally validated in a wide range of vertebrate species (MIPF0000006).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   cu       cgua          ---u g   a 
gcu  agcagca    aauacuggag    g ggg u
|||  |||||||    ||||||||||    | |||  
uga  ucgucgu    uuaugaccuc    u ucc c
   uu       uacg          ucgu g   g 
Get sequence
Genome context
Coordinates (Gallus-gallus-4.0) Overlapping transcripts
chr4: 4023458-4023528 [-]
intergenic
Clustered miRNAs
< 10kb from gga-mir-16c
gga-mir-15c chr4: 4023824-4023899 [-]
gga-mir-16c chr4: 4023458-4023528 [-]
Database links

Mature sequence gga-miR-16c

Accession MIMAT0007739
Sequence

5 - 

uagcagcacguaaauacuggag

 - 26

Get sequence
Evidence experimental; Solexa [1], Northern [2]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).
2
PMID:18511220 "Identification of novel chicken microRNAs and analysis of their genomic organization" Shao P, Zhou H, Xiao ZD, He JH, Huang MB, Chen YQ, Qu LH Gene. 418:34-40(2008).