Stem-loop sequence mml-let-7b

AccessionMI0007573 (change log)
DescriptionMacaca mulatta let-7b stem-loop
Gene family MIPF0000002; let-7
Literature search

5 open access papers mention mml-let-7b
(17 sentences)

Stem-loop
        u                     ----  ---a      u 
5' cgggg gagguaguagguugugugguu    uc    gggcag g
   ||||| |||||||||||||||||||||    ||    |||||| a
3' guccc uuccgucauccaacauaucaa    ag    cccguu u
        -                     uaga  acuc      g 
Get sequence
Deep sequencing
13764795 reads, 9.54e+04 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr10: 88294908-88294990 [+]
sense
ENSMMUT00000043908 ; TBC1D22A-203; intron 6
ENSMMUT00000005326 ; TBC1D22A-201; intron 8
ENSMMUT00000005327 ; TBC1D22A-202; intron 8
Clustered miRNAs
< 10kb from mml-let-7b
mml-let-7a-3chr10: 88293991-88294064 [+]
mml-let-7bchr10: 88294908-88294990 [+]
Database links

Mature sequence mml-let-7b-5p

Accession MIMAT0006152
Sequence

6 - 

ugagguaguagguugugugguu

 - 27

Get sequence
Deep sequencing13764277 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-let-7b-3p

Accession MIMAT0026790
Sequence

60 - 

cuauacaaccuacugccuuccc

 - 81

Get sequence
Deep sequencing504 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).