Stem-loop sequence mml-let-7f-1

AccessionMI0007577 (change log)
DescriptionMacaca mulatta let-7f-1 stem-loop
Gene family MIPF0000002; let-7
Literature search

4 open access papers mention mml-let-7f-1
(7 sentences)

Stem-loop
       a ug                      ---------       u 
5' ucag g  agguaguagauuguauaguugu         gggguag g
   |||| |  ||||||||||||||||||||||         ||||||| a
3' aguc c  uccguuaucuaacauaucaaua         ucccauu u
       - cu                      gaggacuug       u 
Get sequence
Deep sequencing
17195491 reads, 1.21e+05 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr15: 44323112-44323198 [+]
intergenic
Clustered miRNAs
< 10kb from mml-let-7f-1
mml-let-7a-1chr15: 44322723-44322802 [+]
mml-let-7f-1chr15: 44323112-44323198 [+]
mml-let-7dchr15: 44325586-44325672 [+]
Database links

Mature sequence mml-let-7f-5p

Accession MIMAT0006156
Sequence

7 - 

ugagguaguagauuguauaguu

 - 28

Get sequence
Deep sequencing34424192 reads, 9 experiments
Evidence by similarity; MI0000068
Database links
Predicted targets

Mature sequence mml-let-7f-3p

Accession MIMAT0026793
Sequence

63 - 

cuauacaaucuauugccuuccc

 - 84

Get sequence
Deep sequencing181 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).