Stem-loop sequence mml-let-7g

AccessionMI0007579 (change log)
DescriptionMacaca mulatta let-7g stem-loop
Gene family MIPF0000002; let-7
Literature search

4 open access papers mention mml-let-7g
(7 sentences)

Stem-loop
   a   u        a            ugagg    -a  a    a 
5'  ggc gagguagu guuuguacaguu     gucu  ug uacc c
    ||| |||||||| ||||||||||||     ||||  || ||||  
3'  ccg uuccguca cggacaugucaa     uaga  ac augg c
   a   -        c            -----    gg  -    c 
Get sequence
Deep sequencing
13862731 reads, 9.82e+04 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr2: 89955755-89955838 [+]
intergenic
Database links

Mature sequence mml-let-7g-5p

Accession MIMAT0006157
Sequence

5 - 

ugagguaguaguuuguacaguu

 - 26

Get sequence
Deep sequencing13862197 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-let-7g-3p

Accession MIMAT0026794
Sequence

62 - 

cuguacaggccacugccuugcc

 - 83

Get sequence
Deep sequencing531 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).