Stem-loop sequence mml-mir-34b

AccessionMI0007604 (change log)
DescriptionMacaca mulatta miR-34b stem-loop
Gene family MIPF0000039; mir-34
Stem-loop
        cg    -gua       uca    c        -  g 
5' gugcu  guuu    ggcagug   uuag ugauugua cu u
   |||||  ||||    |||||||   |||| |||||||| || g
3' cacgg  caaa    ccgucac   aauc acuaacau gg g
        aa    acua       cuc    -        u  u 
Get sequence
Deep sequencing
6370 reads, 225 reads per million, 8 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr14: 104382402-104382485 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-34b
mml-mir-34bchr14: 104382402-104382485 [+]
mml-mir-34cchr14: 104382905-104382981 [+]
Database links

Mature sequence mml-miR-34b

Accession MIMAT0006174
Sequence

50 - 

caaucacuaacuccacugccau

 - 71

Get sequence
Deep sequencing2470 reads, 6 experiments
Evidence by similarity; MI0000742
Database links
Predicted targets

References

1