Stem-loop sequence mml-mir-92a-2

AccessionMI0007606 (change log)
DescriptionMacaca mulatta miR-92a-2 stem-loop
Gene family MIPF0000013; mir-25
Literature search

1 open access papers mention mml-mir-92a-2
(7 sentences)

Stem-loop
     a   c     g     uu  u   u     -      
5' uc ucc ugggu gggau  gu gca uacuu guguu 
   || ||| ||||| |||||  || ||| ||||| |||| c
3' ag agg guccg cccug  ca cgu augaa uauau 
     a   u     g     uu  -   u     a      
Get sequence
Deep sequencing
169840 reads, 1.4e+03 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 128131893-128131967 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-92a-2
mml-mir-106achrX: 128132553-128132633 [-]
mml-mir-18bchrX: 128132396-128132466 [-]
mml-mir-20bchrX: 128132164-128132232 [-]
mml-mir-19b-2chrX: 128132026-128132121 [-]
mml-mir-92a-2chrX: 128131893-128131967 [-]
mml-mir-363chrX: 128131733-128131807 [-]
Database links

Mature sequence mml-miR-92a-5p

Accession MIMAT0026809
Sequence

9 - 

ggguggggauuuguugcauuacu

 - 31

Get sequence
Deep sequencing6 reads, 4 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-92a-3p

Accession MIMAT0002706
Previous IDsmml-miR-92
Sequence

48 - 

uauugcacuugucccggccugu

 - 69

Get sequence
Deep sequencing339963 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).