Stem-loop sequence mml-mir-103-2

AccessionMI0007611 (change log)
DescriptionMacaca mulatta miR-103-2 stem-loop
Gene family MIPF0000024; mir-103
Literature search

5 open access papers mention mml-mir-103-2
(18 sentences)

Stem-loop
   uu  g      --   u  u           ----    ua 
5'   gu cuuuca  gcu cu uacagugcugc    cuug  g
     || ||||||  ||| || |||||||||||    ||||  c
3'   ca gaaagu  cgg ga auguuacgacg    ggac  a
   ac  a      au   -  c           aacu    uu 
Get sequence
Deep sequencing
977586 reads, 6.18e+03 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr10: 36786820-36786897 [+]
antisense
ENSMMUT00000044526 ; SLC23A1-201; intron 2
Database links

Mature sequence mml-miR-103-3p

Accession MIMAT0002447
Sequence

48 - 

agcagcauuguacagggcuauga

 - 70

Get sequence
Deep sequencing1955038 reads, 9 experiments
Evidence by similarity; MI0000108
Database links
Predicted targets

References

1