Stem-loop sequence mml-mir-125a

AccessionMI0007615 (change log)
DescriptionMacaca mulatta miR-125a stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   u     u u ug  uc  ug   c    ua        ----  a 
5'  gccag c c  gg  cc  aga ccuu  accuguga    gg c
    ||||| | |  ||  ||  ||| ||||  ||||||||    ||  
3'  cgguc g g  cc  gg  ucu ggag  uggacacu    cc a
   c     u c gu  ga  gu   u    --        ggga  u 
Get sequence
Deep sequencing
717486 reads, 3.79e+03 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr19: 46928481-46928566 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-125a
mml-mir-99bchr19: 46927837-46927906 [+]
mml-let-7echr19: 46928012-46928090 [+]
mml-mir-125achr19: 46928481-46928566 [+]
Database links

Mature sequence mml-miR-125a-5p

Accession MIMAT0006181
Sequence

15 - 

ucccugagacccuuuaaccuguga

 - 38

Get sequence
Deep sequencing715670 reads, 9 experiments
Evidence by similarity; MI0000469
Database links
Predicted targets

Mature sequence mml-miR-125a-3p

Accession MIMAT0006182
Sequence

53 - 

acaggugagguucuugggagcc

 - 74

Get sequence
Deep sequencing1814 reads, 9 experiments
Evidence by similarity; MI0000469
Predicted targets

References

1