Stem-loop sequence mml-mir-128b

AccessionMI0007617
DescriptionMacaca mulatta miR-128b stem-loop
Gene family MIPF0000048; mir-128
Stem-loop
   u ug       a          aua      ac    g gag 
5'  g  caguggg aggggggccg   cacugu  gaga u   u
    |  ||||||| ||||||||||   ||||||  |||| |    
3'  u  gucaucc uuucucuggc   gugaca  cucu g   a
   c gu       c          caa      --    g acg 
Get sequence
Deep sequencing
56086 reads, 743 reads per million, 8 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr2: 180559996-180560079 [+]
intergenic
Database links

Mature sequence mml-miR-128b-5p

Accession MIMAT0026814
Sequence

15 - 

gggggccgauacacuguacgaga

 - 37

Get sequence
Deep sequencing11 reads, 3 experiments
Evidence experimental; Illumina [2]

Mature sequence mml-miR-128b-3p

Accession MIMAT0006184
Sequence

52 - 

ucacagugaaccggucucuuu

 - 72

Get sequence
Deep sequencing420 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).