Stem-loop sequence mml-mir-128b

AccessionMI0007617 (change log)
DescriptionMacaca mulatta miR-128b stem-loop
Gene family MIPF0000048; mir-128
Stem-loop
   u ug       a          aua      ac    g gag 
5'  g  caguggg aggggggccg   cacugu  gaga u   u
    |  ||||||| ||||||||||   ||||||  |||| |    
3'  u  gucaucc uuucucuggc   gugaca  cucu g   a
   c gu       c          caa      --    g acg 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr2: 193821063-193821146 [-]
intergenic
Database links

Mature sequence mml-miR-128b-5p

Accession MIMAT0026814
Sequence

15 - 

gggggccgauacacuguacgaga

 - 37

Get sequence
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-128b-3p

Accession MIMAT0006184
Sequence

52 - 

ucacagugaaccggucucuuu

 - 72

Get sequence
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).