Stem-loop sequence mml-mir-138

AccessionMI0007628 (change log)
DescriptionMacaca mulatta miR-138 stem-loop
Gene family MIPF0000075; mir-138
Literature search

1 open access papers mention mml-mir-138
(1 sentences)

Stem-loop
   c u   u  ag             uca     -ac   c  cg 
5'  g ugc gc  cugguguugugaa   ggccg   gag ag  c
    | ||| ||  |||||||||||||   |||||   ||| ||   
3'  c acg ug  gaccacagcacuu   ucggc   uuc uc  a
   a u   u  -g             -ua     cca   -  cu 
Get sequence
Deep sequencing
96662 reads, 411 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr20: 41029997-41030080 [+]
sense
ENSMMUT00000019346 ; NUP93-201; intron 4
Clustered miRNAs
< 10kb from mml-mir-138
mml-mir-138chr20: 41029997-41030080 [+]
mml-mir-7181chr20: 41035061-41035121 [+]
Database links

Mature sequence mml-miR-138-5p

Accession MIMAT0006194
Sequence

10 - 

agcugguguugugaaucaggccg

 - 32

Get sequence
Deep sequencing95948 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-138-3p

Accession MIMAT0026822
Sequence

59 - 

uauuucacgacaccaggguu

 - 78

Get sequence
Deep sequencing708 reads, 6 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).