Stem-loop sequence mml-mir-140

AccessionMI0007630 (change log)
DescriptionMacaca mulatta miR-140 stem-loop
Gene family MIPF0000085; mir-140
Literature search

2 open access papers mention mml-mir-140
(6 sentences)

Stem-loop
   u       ucucu        -  a             a       uu   uc 
5'  gugucuc     guguccug cc gugguuuuacccu ugguagg  acg  a
    |||||||     |||||||| || ||||||||||||| |||||||  |||   
3'  cacgggg     cauaggac gg caccaagauggga accaucu  ugu  u
   c       ----c        a  -             c       --   cg 
Get sequence
Deep sequencing
1495034 reads, 9.12e+03 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr20: 54375562-54375661 [+]
intergenic
Database links

Mature sequence mml-miR-140-5p

Accession MIMAT0006197
Sequence

23 - 

cagugguuuuacccuaugguag

 - 44

Get sequence
Deep sequencing74722 reads, 9 experiments
Evidence by similarity; MI0000456
Database links
Predicted targets

Mature sequence mml-miR-140-3p

Accession MIMAT0006198
Sequence

62 - 

uaccacaggguagaaccacgg

 - 82

Get sequence
Deep sequencing1420276 reads, 9 experiments
Evidence by similarity; MI0000456
Database links
Predicted targets

References

1