![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mml-mir-150 |
|||||
Accession | MI0007641 (change log) | ||||
Description | Macaca mulatta miR-150 stem-loop | ||||
Gene family | MIPF0000197; mir-150 | ||||
Literature search |
2 open access papers mention mml-mir-150 | ||||
Stem-loop |
c u - ac u u - g 5' ucccca gg cccugucuccca ccu guaccag g cug g |||||| || |||||||||||| ||| ||||||| | ||| 3' aggggu cc gggacagggggu gga caugguc c gac c c - a cc - c a u |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
Mature sequence mml-miR-150-5p |
|
Accession | MIMAT0006211 |
Sequence |
16 - ucucccaacccuuguaccagug - 37 |
Deep sequencing | 4000 reads, 9 experiments |
Evidence | experimental; Illumina [2] |
Predicted targets |
|
Mature sequence mml-miR-150-3p |
|
Accession | MIMAT0026828 |
Sequence |
51 - cugguacaggccugggggaca - 71 |
Deep sequencing | 84 reads, 9 experiments |
Evidence | experimental; Illumina [2] |
Predicted targets |
|
References |
|
1 |
PMID:18186931
"Identification of novel homologous microRNA genes in the rhesus macaque genome"
BMC Genomics. 9:8(2008).
|
2 |
PMID:23034410
"Birth and expression evolution of mammalian microRNA genes"
Genome Res. 23:34-45(2013).
|