Stem-loop sequence mml-mir-155

AccessionMI0007645 (change log)
DescriptionMacaca mulatta miR-155 stem-loop
Gene family MIPF0000157; mir-155
Literature search

1 open access papers mention mml-mir-155
(1 sentences)

Stem-loop
                u    a        uuuac 
5' cuguuaaugcuaa cgug uagggguu     c
   ||||||||||||| |||| ||||||||     u
3' gacaauuacgauu guac auccucag     c
                -    -        ucaac 
Get sequence
Deep sequencing
13130 reads, 11.1 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr3: 21414128-21414192 [-]
intergenic
Database links

Mature sequence mml-miR-155

Accession MIMAT0006216
Sequence

4 - 

uuaaugcuaaucgugauaggggu

 - 26

Get sequence
Deep sequencing13130 reads, 9 experiments
Evidence by similarity; MI0000681
Predicted targets

References

1