![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mml-mir-181b-2 |
||||||
Accession | MI0007646 (change log) | |||||
Description | Macaca mulatta miR-181b-2 stem-loop | |||||
Gene family | MIPF0000007; mir-181 | |||||
Literature search |
3 open access papers mention mml-mir-181b-2 | |||||
Stem-loop |
cuga - cucaa cu u gu 5' ugg cugca cauucauug gucgguggguu ga c ||| ||||| ||||||||| ||||||||||| || u 3' acc ggcgu guaaguagc uagucacucaa cu g acaa a caaac -- - aa |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence mml-miR-181b-5p |
|
Accession | MIMAT0002623 |
Sequence |
16 - aacauucauugcugucgguggguu - 39 |
Deep sequencing | 1195673 reads, 9 experiments |
Evidence | experimental; Illumina [2] |
Database links |
|
Predicted targets |
|
Mature sequence mml-miR-181b-2-3p |
|
Accession | MIMAT0031042 |
Sequence |
57 - acugaucgaugaaugcaaa - 75 |
Deep sequencing | 305 reads, 9 experiments |
Evidence | experimental; Illumina [2] |
Predicted targets |
|
References |
|
1 |
PMID:18186931
"Identification of novel homologous microRNA genes in the rhesus macaque genome"
BMC Genomics. 9:8(2008).
|
2 |
PMID:23034410
"Birth and expression evolution of mammalian microRNA genes"
Genome Res. 23:34-45(2013).
|