Stem-loop sequence mml-mir-181d

AccessionMI0007647 (change log)
DescriptionMacaca mulatta miR-181d stem-loop
Gene family MIPF0000007; mir-181
Literature search

3 open access papers mention mml-mir-181d
(4 sentences)

Stem-loop
         --      -     ----aca   aa       auca         g ug          guga  a c 
5' gucccc  uccccu aggcc       gcc  ggucaca    acauucauu u  ucgguggguu    gg c g
   ||||||  |||||| |||||       |||  |||||||    ||||||||| |  ||||||||||    || |  
3' cagggg  agggga uucgg       cgg  ucggugu    uguaaguag g  ggccacccag    cc g a
         ua      a     cacagac   -g       -cac         g --          ---a  - g 
Get sequence
Deep sequencing
546805 reads, 2.86e+03 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr19: 13878707-13878843 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-181d
mml-mir-181cchr19: 13878531-13878640 [+]
mml-mir-181dchr19: 13878707-13878843 [+]
Database links

Mature sequence mml-miR-181d

Accession MIMAT0006217
Sequence

36 - 

aacauucauuguugucggugggu

 - 58

Get sequence
Deep sequencing546780 reads, 9 experiments
Evidence by similarity; MI0003139
Database links
Predicted targets

References

1