![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mml-mir-208a |
|||||
Accession | MI0007668 (change log) | ||||
Description | Macaca mulatta miR-208a stem-loop | ||||
Gene family | MIPF0000178; mir-208 | ||||
Literature search |
1 open access papers mention mml-mir-208a | ||||
Stem-loop |
u ag g c gg c a 5' gac gcgagcuuuu gc cg uuauac ug u ||| |||||||||| || || |||||| || g 3' cug uguucgaaaa cg gc aauaug ac c a gu a a ag c u |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
Mature sequence mml-miR-208a-5p |
|
Accession | MIMAT0026844 |
Sequence |
9 - gagcuuuuggcccggguuauac - 30 |
Deep sequencing | 190 reads, 1 experiments |
Evidence | experimental; Illumina [2] |
Predicted targets |
|
Mature sequence mml-miR-208a-3p |
|
Accession | MIMAT0006238 |
Sequence |
44 - auaagacgagcaaaaagcuugu - 65 |
Deep sequencing | 1101 reads, 3 experiments |
Evidence | experimental; Illumina [2] |
Predicted targets |
|
References |
|
1 |
PMID:18186931
"Identification of novel homologous microRNA genes in the rhesus macaque genome"
BMC Genomics. 9:8(2008).
|
2 |
PMID:23034410
"Birth and expression evolution of mammalian microRNA genes"
Genome Res. 23:34-45(2013).
|