![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mml-mir-208b |
|||||
Accession | MI0007669 (change log) | ||||
Description | Macaca mulatta miR-208b stem-loop | ||||
Gene family | MIPF0000178; mir-208 | ||||
Literature search |
1 open access papers mention mml-mir-208b | ||||
Stem-loop |
--c g c aa cu 5' cucucagg aagcuuuuug ucg uuauguuu g |||||||| |||||||||| ||| |||||||| a 3' gggagucu uuuggaaaac agc aauauaag u gac g a ag cc |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence mml-miR-208b-5p |
|
Accession | MIMAT0026845 |
Sequence |
11 - aagcuuuuugcucgaauuaugu - 32 |
Deep sequencing | 5 reads, 1 experiments |
Evidence | experimental; Illumina [2] |
Predicted targets |
|
Mature sequence mml-miR-208b-3p |
|
Accession | MIMAT0006239 |
Sequence |
46 - auaagacgaacaaaagguuugu - 67 |
Deep sequencing | 677 reads, 6 experiments |
Evidence | experimental; Illumina [2] |
Predicted targets |
|
References |
|
1 |
PMID:18186931
"Identification of novel homologous microRNA genes in the rhesus macaque genome"
BMC Genomics. 9:8(2008).
|
2 |
PMID:23034410
"Birth and expression evolution of mammalian microRNA genes"
Genome Res. 23:34-45(2013).
|