Stem-loop sequence mml-mir-299

AccessionMI0007684 (change log)
DescriptionMacaca mulatta miR-299 stem-loop
Gene family MIPF0000186; mir-299
Literature search

1 open access papers mention mml-mir-299
(19 sentences)

        a                      uu 
5' aagaa ugguuuaccgucccacauacau  u
   ||||| ||||||||||||||||||||||  c
3' uucuu gccaaauggcaggguguaugua  a
        c                      ua 
Get sequence
Deep sequencing
36418 reads, 111 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 163359095-163359157 [+]
Clustered miRNAs
< 10kb from mml-mir-299
mml-mir-379chr7: 163357370-163357436 [+]
mml-mir-411chr7: 163358629-163358710 [+]
mml-mir-299chr7: 163359095-163359157 [+]
mml-mir-380chr7: 163360318-163360378 [+]
mml-mir-323achr7: 163361034-163361119 [+]
mml-mir-758chr7: 163361327-163361414 [+]
mml-mir-329-1chr7: 163362091-163362174 [+]
mml-mir-329-2chr7: 163362410-163362489 [+]
mml-mir-494chr7: 163364071-163364151 [+]
mml-mir-543chr7: 163366417-163366496 [+]
mml-mir-495chr7: 163368266-163368347 [+]
Database links

Mature sequence mml-miR-299-5p

Accession MIMAT0006255

7 - 


 - 28

Get sequence
Deep sequencing2536 reads, 9 experiments
Evidence by similarity; MI0000744
Predicted targets

Mature sequence mml-miR-299-3p

Accession MIMAT0006256

39 - 


 - 60

Get sequence
Deep sequencing33882 reads, 9 experiments
Evidence by similarity; MI0000744
Database links
Predicted targets
