Stem-loop sequence mml-mir-345

AccessionMI0007705 (change log)
DescriptionMacaca mulatta miR-345 stem-loop
Gene family MIPF0000189; mir-345
Literature search

1 open access papers mention mml-mir-345
(1 sentences)

Stem-loop
   -------      u     gg u  cu   a  ca        ug u 
5'        aaaccc agguc  c ga  ccu gu  agggcucg  g g
          |||||| |||||  | ||  ||| ||  ||||||||  |  
3'        uuuggg uccgg  g cu  gga ca  ucccgggu  u g
   cuauaag      -     ag u  ug   g  ag        gg c 
Get sequence
Deep sequencing
9 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 162634511-162634598 [+]
intergenic
Database links

Mature sequence mml-miR-345

Accession MIMAT0006284
Sequence

14 - 

gcugacuccuagucaagggcuc

 - 35

Get sequence
Evidence by similarity; MI0000825
Predicted targets

References

1