Stem-loop sequence mml-mir-372

AccessionMI0007716 (change log)
DescriptionMacaca mulatta miR-372 stem-loop
Gene family MIPF0000068; mir-290
Literature search

2 open access papers mention mml-mir-372
(2 sentences)

Stem-loop
        c         g -      a    gaug 
5' gugau cucaaaugu g agcacu uucu    u
   ||||| ||||||||| | |||||| ||||    c
3' cacug gaguuuaca c ucguga aagg    c
        c         g g      -    ugaa 
Get sequence
Deep sequencing
1511 reads, 57.1 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr19: 49142277-49142343 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-372
mml-mir-371chr19: 49142068-49142137 [+]
mml-mir-372chr19: 49142277-49142343 [+]
mml-mir-373chr19: 49142984-49143052 [+]
Database links

Mature sequence mml-miR-372-5p

Accession MIMAT0026858
Sequence

6 - 

ccucaaauguggagcacuauucu

 - 28

Get sequence
Deep sequencing12 reads, 3 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-372-3p

Accession MIMAT0006298
Sequence

42 - 

aaagugcugcgacauuugagcgu

 - 64

Get sequence
Deep sequencing1499 reads, 7 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).