Stem-loop sequence mml-mir-374b

AccessionMI0007719 (change log)
DescriptionMacaca mulatta miR-374b stem-loop
Gene family MIPF0000288; mir-374
Literature search

1 open access papers mention mml-mir-374b
(1 sentences)

   --  u    ug au                     c 
5'   ac cgga  g  auaauacaaccugcuaagugu c
     || ||||  |  |||||||||||||||||||||  
3'   ug gccu  u  uauuauguuggacgauucacg u
   uc  u    gu ac                     a 
Get sequence
Deep sequencing
9697 reads, 11.1 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 68772068-68772139 [-]
Clustered miRNAs
< 10kb from mml-mir-374b
mml-mir-374bchrX: 68772068-68772139 [-]
mml-mir-421chrX: 68771903-68771981 [-]
Database links

Mature sequence mml-miR-374b-5p

Accession MIMAT0006301

11 - 


 - 32

Get sequence
Deep sequencing9017 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-374b-3p

Accession MIMAT0026860

42 - 


 - 62

Get sequence
Deep sequencing680 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets


PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).