Stem-loop sequence mml-mir-375

AccessionMI0007720 (change log)
DescriptionMacaca mulatta miR-375 stem-loop
Gene family MIPF0000114; mir-375
Literature search

1 open access papers mention mml-mir-375
(2 sentences)

Stem-loop
   c  -    a      ccu  c     c  gac 
5'  cc cgcg cgagcc   cg acaaa cg   c
    || |||| ||||||   || ||||| ||    
3'  gg gugc gcucgg   gc uguuu gc   u
   c  a    -      cuu  u     u  gag 
Get sequence
Deep sequencing
10255 reads, 411 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr12: 101126188-101126251 [-]
antisense
ENSMMUT00000024392 ; WNT10A-201; intron 2
Database links

Mature sequence mml-miR-375

Accession MIMAT0006302
Sequence

40 - 

uuuguucguucggcucgcguga

 - 61

Get sequence
Deep sequencing10255 reads, 9 experiments
Evidence by similarity; MI0000783
Predicted targets

References

1