Stem-loop sequence mml-mir-378a

AccessionMI0007726 (change log)
Previous IDsmml-mir-378
DescriptionMacaca mulatta miR-378a stem-loop
Gene family MIPF0000168; mir-378
Literature search

1 open access papers mention mml-mir-378a
(2 sentences)

Stem-loop
      g  c              ugu      ccu 
5' agg cu cugacuccaggucc   guguua   c
   ||| || ||||||||||||||   ||||||    
3' ucc ga gacugagguucagg   cacgau   g
      g  a              --u      aaa 
Get sequence
Deep sequencing
7515034 reads, 4.79e+04 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr6: 147861394-147861459 [+]
intergenic
Database links

Mature sequence mml-miR-378a

Accession MIMAT0006307
Previous IDsmml-miR-378
Sequence

43 - 

acuggacuuggagucagaagg

 - 63

Get sequence
Deep sequencing7514111 reads, 9 experiments
Evidence by similarity; MI0000786
Database links
Predicted targets

References

1