miRBase entry: mml-mir-412

Stem-loop mml-mir-412


Accession
MI0007736
Description
Macaca mulatta mml-mir-412 precursor miRNA


Sequence

890 reads, 6 reads per million, 8 experiments
cugggguacggggauggaUGGUCGACCAGUUGGAAAGUaauuguuucuaauguACUUCACCUGGUCCACUAGCCGUccguauccgcugcag
...((((((..((((((.((((.((((((.(((..((((((((....)))).))))))).)))))).)))).)))))))))))).......

Structure
----cug      gg      a    C      U   AA    -    u 
       ggguac  ggaugg UGGU GACCAG UGG  AGUa auug u
       ||||||  |||||| |||| |||||| |||  |||| ||||  
       ccuaug  ccUGCC AUCA CUGGUC ACU  UCAu uaau u
gacgucg      --      G    C      C   --    g    c 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chr7: 163399243-163399333 [+]
Clustered miRNAs
11 other miRNAs are < 10 kb from mml-mir-412
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mml-miR-412-3p

Accession MIMAT0006318
Description Macaca mulatta mml-miR-412-3p mature miRNA
Sequence 54 - ACUUCACCUGGUCCACUAGCCGU - 76
Evidence experimental
Illumina [2]

Mature mml-miR-412-5p

Accession MIMAT0026871
Description Macaca mulatta mml-miR-412-5p mature miRNA
Sequence 19 - UGGUCGACCAGUUGGAAAGU - 38
Evidence experimental
Illumina [2]

References

  1. PubMed ID: 18186931
    Identification of novel homologous microRNA genes in the rhesus macaque genome
    Yue J, Sheng Y, Orwig KE
    BMC Genomics (2008) 9:8

  2. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45