![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mml-mir-412 |
||||||||||||||||||||||||||
Accession | MI0007736 (change log) | |||||||||||||||||||||||||
Description | Macaca mulatta miR-412 stem-loop | |||||||||||||||||||||||||
Gene family | MIPF0000192; mir-412 | |||||||||||||||||||||||||
Stem-loop |
----cug gg a c u aa - u 5' ggguac ggaugg uggu gaccag ugg agua auug u |||||| |||||| |||| |||||| ||| |||| |||| 3' ccuaug ccugcc auca cugguc acu ucau uaau u gacgucg -- g c c -- g c |
|||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||
Database links |
Mature sequence mml-miR-412-5p |
|
Accession | MIMAT0026871 |
Sequence |
19 - uggucgaccaguuggaaagu - 38 |
Deep sequencing | 1025 reads, 9 experiments |
Evidence | experimental; Illumina [2] |
Predicted targets |
|
Mature sequence mml-miR-412-3p |
|
Accession | MIMAT0006318 |
Sequence |
54 - acuucaccugguccacuagccgu - 76 |
Deep sequencing | 14 reads, 5 experiments |
Evidence | experimental; Illumina [2] |
Predicted targets |
|
References |
|
1 |
PMID:18186931
"Identification of novel homologous microRNA genes in the rhesus macaque genome"
BMC Genomics. 9:8(2008).
|
2 |
PMID:23034410
"Birth and expression evolution of mammalian microRNA genes"
Genome Res. 23:34-45(2013).
|