Stem-loop sequence mml-mir-448

AccessionMI0007746 (change log)
DescriptionMacaca mulatta miR-448 stem-loop
Gene family MIPF0000149; mir-448
Literature search

1 open access papers mention mml-mir-448
(1 sentences)

Stem-loop
   -----------  c       u a            g   u     ga au    a  uc 
5'            gc gggaggu g acauccugcaua ugc gccag  a  cccu uu  a
              || ||||||| | |||||||||||| ||| |||||  |  |||| ||  u
3'            cg cccucua c uguaggauguau acg ugguc  u  ggga aa  a
   acugcuucauc  a       c c            -   u     gg cg    g  uc 
Get sequence
Deep sequencing
242 reads, 0 reads per million, 7 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 108672772-108672882 [+]
antisense
ENSMMUT00000024354 ; LRCH2-202; intron 1
Database links

Mature sequence mml-miR-448

Accession MIMAT0006329
Sequence

71 - 

uugcauauguaggaugucccau

 - 92

Get sequence
Deep sequencing199 reads, 7 experiments
Evidence by similarity; MI0001637
Predicted targets

References

1