Stem-loop sequence vvi-MIR156h

AccessionMI0007939 (change log)
DescriptionVitis vinifera miR156h stem-loop
Literature search

11 open access papers mention vvi-MIR156h
(92 sentences)

Stem-loop
   u  --cu        c  aa -         augcuggugggaaaacaauuacaacuuuugaucaucugaucuggaaaugcuuguaagcggcauucucuuggauuguaaucuga 
5'  gc    cacaauga ag  g agagagagc                                                                                   a
    ||    |||||||| ||  | |||||||||                                                                                   u
3'  cg    guguuacu uc  c ucuuucuug                                                                                   u
   c  uccu        u  cg g         agucgacuaguacgucuuccgaguucggccuuuccgugagucaacuuccuuuagcaaacacccguccaacuacuaucuccguc 
Get sequence
Deep sequencing
541628 reads, 3.62e+04 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr12: 4108571-4108798 [+]
intergenic
Database links

Mature sequence vvi-miR156h

Accession MIMAT0006544
Sequence

11 - 

ugacagaagagagagagcau

 - 30

Get sequence
Deep sequencing541626 reads, 2 experiments
Evidence by similarity; MI0001752

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).