miRBase entry: vvi-MIR169h

Stem-loop vvi-MIR169h


Accession
MI0007941
Description
Vitis vinifera vvi-MIR169h precursor miRNA
Gene family
MIPF0000037; MIR169_2

Literature search
8 open access papers mention vvi-MIR169h
(15 sentences)

Sequence

55 reads, 4 reads per million, 2 experiments
aggguggaauUGAGCCAAGGAUGGCUUGCCGuccuuugucacuauuugaggcauuaacuggucacgcacggaggguuauccuugacuccuuuagcuccucu
.((((.(((..(((.((((((((((((.((((....(((.((((.((((....)))).)))).))).)))).)))))))))))).))).))).))))....

Structure
---a    g   uU   C            G    ccuu   c    u    g 
    gggu gaa  GAG CAAGGAUGGCUU CCGu    ugu acua uuga g
    |||| |||  ||| |||||||||||| ||||    ||| |||| ||||  
    cucg uuu  cuc guuccuauuggg ggca    gca uggu aauu c
ucuc    a   -c   a            a    ---c   c    c    a 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr11: 16151651-16151751 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from vvi-MIR169h
Name Accession Chromosome Start End Strand Confidence




Database links

Mature vvi-miR169h

Accession MIMAT0006546
Description Vitis vinifera vvi-miR169h mature miRNA
Sequence 11 - UGAGCCAAGGAUGGCUUGCCG - 31
Evidence experimental
Array [2]

References

  1. PubMed ID: 17721507
    The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla
    "Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro"
    "Nature (2007) 449:463-467

  2. PubMed ID: 19939267
    High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera
    Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pè ME, Horner DS
    BMC Genomics (2009) 10:558