Stem-loop sequence vvi-MIR169i

AccessionMI0007942 (change log)
DescriptionVitis vinifera miR169i stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

8 open access papers mention vvi-MIR169i
(17 sentences)

Stem-loop
   ---a    gg  uu   c  a       ug     -   uuu        uauu 
5'     gggu  aa  gag ca ggaugac  gccgu cau   ucaguugg    u
       ||||  ||  ||| || |||||||  ||||| |||   ||||||||    g
3'     cucg  uu  cuc gu ccuauug  cggca gua   ggucaauu    a
   ucuc    -a  uc   u  c       gu     c   -cu        ucgg 
Get sequence
Deep sequencing
2205 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr11: 16158014-16158118 [+]
intergenic
Clustered miRNAs
< 10kb from vvi-MIR169i
vvi-MIR169hchr11: 16151651-16151751 [+]
vvi-MIR169ichr11: 16158014-16158118 [+]
Database links

Mature sequence vvi-miR169i

Accession MIMAT0006547
Sequence

12 - 

gagccaaggaugacuggccgu

 - 32

Get sequence
Deep sequencing2199 reads, 2 experiments
Evidence experimental; Array [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).