Stem-loop sequence vvi-MIR169q

Accession MI0007946
Description Vitis vinifera miR169q stem-loop
Gene family MIPF0000037; MIR169_2
Stem-loop
--    ug           a    g  u       au  g    a   c 
  aggg  gaauagagcca ggau ac ugccggc  uu cagu agu u
  ||||  ||||||||||| |||| || |||||||  || |||| |||  
  uccu  uuuaucucggu ccua ug acggccg  aa guca uua a
uc    gg           -    a  u       ac  g    a   u 
Get sequence
Deep sequencing
10 reads, 24.7 reads per million, 3 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Genoscope-20100122) Overlapping transcripts
chr11: 16384484-16384580 [+]
intergenic
Clustered miRNAs
< 10kb from vvi-MIR169q
vvi-MIR169n chr11: 16380240-16380340 [+]
vvi-MIR169q chr11: 16384484-16384580 [+]
Database links

Mature sequence vvi-miR169q

Accession MIMAT0006551
Sequence

12 - 

gagccaaggaugacuugccgg

 - 32

Get sequence
Deep sequencing 3 reads, 3 experiments
Evidence experimental; Array [19939267]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).