Stem-loop sequence vvi-MIR169v

AccessionMI0007947 (change log)
DescriptionVitis vinifera miR169v stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

8 open access papers mention vvi-MIR169v
(17 sentences)

Stem-loop
         --g    a         -           - g   ---     a 
5' agggag   aaca agccaagga ugaauugccgg c aug   aaagu g
   ||||||   |||| ||||||||| ||||||||||| | |||   ||||| g
3' ucucuc   uugu ucgguucuu auuuaacggcu g uac   uuucg c
         ggg    a         u           a g   cug     a 
Get sequence
Deep sequencing
1603 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr11: 16468025-16468120 [+]
intergenic
Database links

Mature sequence vvi-miR169v

Accession MIMAT0006552
Sequence

12 - 

aagccaaggaugaauugccgg

 - 32

Get sequence
Deep sequencing1601 reads, 2 experiments
Evidence experimental; Array [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).