Stem-loop sequence vvi-MIR169x

AccessionMI0007949 (change log)
DescriptionVitis vinifera miR169x stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

8 open access papers mention vvi-MIR169x
(19 sentences)

Stem-loop
   --   uc   -ugg     -     -     u       -u    cagguuucaaaacacugaau 
5'   guc  guc    uagcc aagga ugacu gccuaaa  ccac                    g
     |||  |||    ||||| ||||| ||||| |||||||  ||||                    u
3'   cgg  cag    aucgg uuccu acuga cggauuu  ggug                    a
   cu   -c   ucaa     c     u     -       cu    ccuuagcgaaacaccuauua 
Get sequence
Deep sequencing
3974 reads, 250 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr17: 355713-355837 [-]
intergenic
Database links

Mature sequence vvi-miR169x

Accession MIMAT0006554
Sequence

12 - 

uagccaaggaugacuugccua

 - 32

Get sequence
Deep sequencing3972 reads, 2 experiments
Evidence experimental; Array [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).