Stem-loop sequence vvi-MIR171g

AccessionMI0007950 (change log)
DescriptionVitis vinifera miR171g stem-loop
Literature search

5 open access papers mention vvi-MIR171g
(16 sentences)

Stem-loop
   gcca c   --ucc          -ca    u    gac 
5'     g cuc     auguugguuc   ucgg gggg   a
       | |||     ||||||||||   |||| ||||    
3'     c gag     uauaaccaag   aguu ccuc   c
   uaaa c   cccac          ccg    -    aac 
Get sequence
Deep sequencing
1641 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr18: 3255625-3255700 [+]
intergenic
Database links

Mature sequence vvi-miR171g

Accession MIMAT0006555
Sequence

46 - 

uugagccgaaccaauaucacc

 - 66

Get sequence
Deep sequencing1641 reads, 2 experiments
Evidence experimental; Array [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).