Stem-loop sequence vvi-MIR319e

AccessionMI0007951 (change log)
DescriptionVitis vinifera miR319e stem-loop
Gene family MIPF0001104; MIR319
Literature search

7 open access papers mention vvi-MIR319e
(25 sentences)

Stem-loop
   --u c    a             g   c         cuccauc  -     aaga 
5'    g agaa uggggguuccuuu cag ccaaaacaa       gc ugaag    u
      | |||| ||||||||||||| ||| |||||||||       || |||||    g
3'    c ucuu auccucgagggaa guc gguuuuguu       cg acuuc    a
   ucu u    g             -   a         ----ccu  u     aagu 
Get sequence
Deep sequencing
17422 reads, 1.05e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr11: 4317224-4317330 [+]
intergenic
Database links

Mature sequence vvi-miR319e

Accession MIMAT0006556
Sequence

76 - 

uuuggacugaagggagcuccu

 - 96

Get sequence
Deep sequencing17421 reads, 2 experiments
Evidence experimental; Array [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).