Stem-loop sequence vvi-MIR394c

AccessionMI0007953 (change log)
DescriptionVitis vinifera miR394c stem-loop
Gene family MIPF0000100; MIR394
Literature search

3 open access papers mention vvi-MIR394c
(5 sentences)

Stem-loop
   --        u            u  a      uauauaccaauucuucug 
5'   cagagcca uuuggcauucug cc ccucca                  a
     |||||||| |||||||||||| || ||||||                   
3'   gucucggu aaaccguaggac gg ggaggu                  a
   au        u            c  c      uugcgaacacccgcgguu 
Get sequence
Deep sequencing
59 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr18: 3551260-3551361 [-]
intergenic
Database links

Mature sequence vvi-miR394c

Accession MIMAT0006558
Sequence

11 - 

uuggcauucuguccaccuccau

 - 32

Get sequence
Deep sequencing49 reads, 2 experiments
Evidence experimental; Illumina [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).