Stem-loop sequence vvi-MIR395n

AccessionMI0007954 (change log)
DescriptionVitis vinifera miR395n stem-loop
Gene family MIPF0000016; MIR395
Literature search

6 open access papers mention vvi-MIR395n
(23 sentences)

   --   c ug        c   ac c  c     ugaccaucucucuucuucuuuuaauuuguucauca 
5'   ggc u  agaguucc cca  c cu cagua                                   a
     ||| |  |||||||| |||  | || |||||                                   a
3'   ccg g  ucucaagg ggu  g ga gucau                                   u
   ca   u gu        a   cu a  a     cuccuuuagugggaccuuuaucuaucaucuucuuc 
Get sequence
Deep sequencing
6 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr17: 6408995-6409131 [-]
Database links

Mature sequence vvi-miR395n

Accession MIMAT0006559

107 - 


 - 127

Get sequence
Deep sequencing4 reads, 2 experiments
Evidence experimental; Array [2]


PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).